ID: 1102257566_1102257575

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1102257566 1102257575
Species Human (GRCh38) Human (GRCh38)
Location 12:111425093-111425115 12:111425119-111425141
Sequence CCTGCAGTTGGGCCCCAGCTCTG CCGACCTGCTGTGTGACCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 345} {0: 1, 1: 0, 2: 5, 3: 61, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!