ID: 1102297440_1102297451

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1102297440 1102297451
Species Human (GRCh38) Human (GRCh38)
Location 12:111747908-111747930 12:111747957-111747979
Sequence CCTGGGGTATGAGCCCCCAGCCA TTCACCTGATTCCAAGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 217} {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!