ID: 1102316607_1102316609

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1102316607 1102316609
Species Human (GRCh38) Human (GRCh38)
Location 12:111893485-111893507 12:111893513-111893535
Sequence CCAAGACATTTTTGTGGCTGTCA GACTGCTTGCTGGAACTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 201} {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!