ID: 1102360709_1102360718

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1102360709 1102360718
Species Human (GRCh38) Human (GRCh38)
Location 12:112285292-112285314 12:112285332-112285354
Sequence CCTACCCCTGGTGTCCAAGACCT TCCCTAGACCTTCCAGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185} {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!