ID: 1102381318_1102381325

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1102381318 1102381325
Species Human (GRCh38) Human (GRCh38)
Location 12:112469062-112469084 12:112469094-112469116
Sequence CCAACAACAAAAAAAAAGATTAA CTGGCAGACCTGATGATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 511, 4: 5089} {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!