ID: 1102419927_1102419929

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1102419927 1102419929
Species Human (GRCh38) Human (GRCh38)
Location 12:112795428-112795450 12:112795443-112795465
Sequence CCAGGATGGAGAGCCTTGATGTG TTGATGTGCTGAAAGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 142, 4: 3302} {0: 1, 1: 0, 2: 0, 3: 22, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!