ID: 1102458783_1102458797

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102458783 1102458797
Species Human (GRCh38) Human (GRCh38)
Location 12:113087468-113087490 12:113087485-113087507
Sequence CCCCAGGCTGTGTTCCCCAGGAC CAGGACTGTGGGGGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 262} {0: 1, 1: 0, 2: 9, 3: 98, 4: 1097}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!