ID: 1102461153_1102461156

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1102461153 1102461156
Species Human (GRCh38) Human (GRCh38)
Location 12:113100293-113100315 12:113100322-113100344
Sequence CCTTAGCTTCTTTTTTTGGGGGT AGAGTCTTGCTGTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 283} {0: 425, 1: 9704, 2: 42176, 3: 103572, 4: 180336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!