ID: 1102488738_1102488744

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102488738 1102488744
Species Human (GRCh38) Human (GRCh38)
Location 12:113276196-113276218 12:113276213-113276235
Sequence CCTTTGATCCACAGGGAAAAAAT AAAAATGGGGGACCAGTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 298} {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!