ID: 1102514503_1102514516

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1102514503 1102514516
Species Human (GRCh38) Human (GRCh38)
Location 12:113437283-113437305 12:113437329-113437351
Sequence CCCATGAGGGCTGGTGTGTCTTA TTCCTGGCATAGGGCATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103} {0: 1, 1: 0, 2: 2, 3: 26, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!