ID: 1102585592_1102585600

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1102585592 1102585600
Species Human (GRCh38) Human (GRCh38)
Location 12:113920565-113920587 12:113920613-113920635
Sequence CCTGCCAAGTGCCTCCGTGGCCC GGAGCTGCTTGAGAGCTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191} {0: 1, 1: 0, 2: 2, 3: 19, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!