ID: 1102646164_1102646171

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1102646164 1102646171
Species Human (GRCh38) Human (GRCh38)
Location 12:114405350-114405372 12:114405363-114405385
Sequence CCCTCGCCAGGGTCCCGGGGAGC CCCGGGGAGCTCTGGGCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 173} {0: 1, 1: 1, 2: 3, 3: 62, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!