ID: 1102843823_1102843827

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102843823 1102843827
Species Human (GRCh38) Human (GRCh38)
Location 12:116155898-116155920 12:116155915-116155937
Sequence CCAGTATGTATTTTCATATTAGA ATTAGAAATAGTAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 286} {0: 1, 1: 0, 2: 4, 3: 18, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!