ID: 1102909949_1102909954

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1102909949 1102909954
Species Human (GRCh38) Human (GRCh38)
Location 12:116705686-116705708 12:116705727-116705749
Sequence CCCAACTCCGCAGTGGCGTGCAA CATCCTTCAAAGCCCTTTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 42} {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!