ID: 1102913757_1102913764 |
View in Genome Browser |
Spacer: -10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1102913757 | 1102913764 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 12:116737897-116737919 | 12:116737910-116737932 |
Sequence | CCATCCCGGCGCGGACGTGGGGC | GACGTGGGGCGCGGCGGCCGGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 93} | {0: 1, 1: 0, 2: 7, 3: 39, 4: 390} |
Status | Complete |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
333 | 7:5423183-5423205 | GCCCCTCGGCCGGGCCAGGAGGG | + | 7:5423539-5423561 | CCGCGGCCGCCGCTCCCCTCCGC | - | ||
-10 | X:130645691-130645713 | CCCCAGCAGCCGCGCCCCACATC | - | X:130645704-130645726 | GCCCCACATCCACGCTGGGATGG | + | ||
-10 | 12:116737897-116737919 | CCATCCCGGCGCGGACGTGGGGC | - | 12:116737910-116737932 | GACGTGGGGCGCGGCGGCCGGGG | + | ||
164 | 19:35717919-35717941 | CCGCGGCCGCCCCGCCCCGCCCC | - | 19:35718106-35718128 | GGCGGGGGCCGCGGCGGACGGGG | + |