ID: 1102914357_1102914366

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1102914357 1102914366
Species Human (GRCh38) Human (GRCh38)
Location 12:116741899-116741921 12:116741937-116741959
Sequence CCTTGATCTCTCAAAGCCCTGGG CACTGCACCTGGCATGGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 52, 3: 1123, 4: 15338} {0: 1, 1: 3, 2: 7, 3: 90, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!