ID: 1102924291_1102924299

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1102924291 1102924299
Species Human (GRCh38) Human (GRCh38)
Location 12:116815104-116815126 12:116815155-116815177
Sequence CCGGTCCTAGTAGTAGTAGATGT CAGAGGCCACTCCCAGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59} {0: 1, 1: 0, 2: 9, 3: 51, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!