ID: 1102941298_1102941301

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1102941298 1102941301
Species Human (GRCh38) Human (GRCh38)
Location 12:116944686-116944708 12:116944708-116944730
Sequence CCCCTAAATTAGTGTTGGAAAAC CAAAATGCTAATAGTTAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 1053} {0: 1, 1: 0, 2: 2, 3: 48, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!