|
Left Crispr |
Right Crispr |
Crispr ID |
1102971111 |
1102971120 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:117167573-117167595
|
12:117167617-117167639
|
Sequence |
CCCGGTCTCTACAAAAAAATTGG |
TGTAGTCCCAGCTACTCGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 6, 2: 176, 3: 1988, 4: 9838} |
{0: 54131, 1: 174214, 2: 265888, 3: 193370, 4: 113909} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|