ID: 1102990949_1102990958

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1102990949 1102990958
Species Human (GRCh38) Human (GRCh38)
Location 12:117315618-117315640 12:117315666-117315688
Sequence CCACAAGTCTGTTCAACCTGGAT GCAGTGTAGCATGCTGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 80} {0: 1, 1: 0, 2: 5, 3: 25, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!