ID: 1103011420_1103011426

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1103011420 1103011426
Species Human (GRCh38) Human (GRCh38)
Location 12:117461240-117461262 12:117461289-117461311
Sequence CCAGCCTGGGTGACAGAGCAAGA CCTAACAAACAAACTCATTGGGG
Strand - +
Off-target summary {0: 26457, 1: 73050, 2: 147182, 3: 159645, 4: 143243} {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!