ID: 1103046045_1103046052

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103046045 1103046052
Species Human (GRCh38) Human (GRCh38)
Location 12:117735351-117735373 12:117735372-117735394
Sequence CCAGAAGCCTGGCGCCTGCCAGT GTGGCCAAGCGGAGAGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 172} {0: 1, 1: 0, 2: 4, 3: 35, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!