ID: 1103049953_1103049962

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1103049953 1103049962
Species Human (GRCh38) Human (GRCh38)
Location 12:117770437-117770459 12:117770478-117770500
Sequence CCTGCCAACACCCGATTTCAGAC GTGGGAAAGTATGTTTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 115} {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!