|
Left Crispr |
Right Crispr |
| Crispr ID |
1103115950 |
1103115959 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:118332050-118332072
|
12:118332081-118332103
|
| Sequence |
CCTGACCTCAGGTGATCCTTCCA |
TCCCACAGTGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 37, 1: 2025, 2: 28169, 3: 74642, 4: 125501} |
{0: 2641, 1: 295980, 2: 261775, 3: 149501, 4: 132181} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|