ID: 1103206267_1103206271

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1103206267 1103206271
Species Human (GRCh38) Human (GRCh38)
Location 12:119131416-119131438 12:119131440-119131462
Sequence CCCTTCTACAGATAGGAAAGAAG ATCAAGGCTCAGAGAGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 75, 4: 653} {0: 1, 1: 7, 2: 55, 3: 248, 4: 899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!