ID: 1103316044_1103316052

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1103316044 1103316052
Species Human (GRCh38) Human (GRCh38)
Location 12:120056771-120056793 12:120056803-120056825
Sequence CCTAGATGGATGTGGAGACCTGG GGCTGCAGCTGGGGAACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188} {0: 1, 1: 0, 2: 4, 3: 87, 4: 699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!