ID: 1103318765_1103318777

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1103318765 1103318777
Species Human (GRCh38) Human (GRCh38)
Location 12:120077951-120077973 12:120078001-120078023
Sequence CCTGCGTCCCTCTGGTTTCCCTC ACATAGGATACAAAGGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 272} {0: 1, 1: 0, 2: 0, 3: 17, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!