ID: 1103335269_1103335275

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1103335269 1103335275
Species Human (GRCh38) Human (GRCh38)
Location 12:120184630-120184652 12:120184649-120184671
Sequence CCATCCCCATTCTGCAGACAAGG AAGGAAACTGAGGCACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 5, 3: 57, 4: 381} {0: 67, 1: 617, 2: 2313, 3: 5592, 4: 10272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!