ID: 1103360959_1103360973

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1103360959 1103360973
Species Human (GRCh38) Human (GRCh38)
Location 12:120353319-120353341 12:120353371-120353393
Sequence CCAGGGGCGAGGCCTGTATAACT CTGGGTAACCTGATGGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41} {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!