ID: 1103380150_1103380153

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1103380150 1103380153
Species Human (GRCh38) Human (GRCh38)
Location 12:120487909-120487931 12:120487940-120487962
Sequence CCATAAAACAAAGGAAAATTTGT TCCCTATGTTGAGGGAGTACTGG
Strand - +
Off-target summary {0: 26, 1: 17, 2: 18, 3: 83, 4: 931} {0: 1, 1: 20, 2: 41, 3: 36, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!