ID: 1103430568_1103430572

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1103430568 1103430572
Species Human (GRCh38) Human (GRCh38)
Location 12:120881695-120881717 12:120881746-120881768
Sequence CCATACAGTCAAGTATTATCCAG CGCTAAATATAGATGAAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 534} {0: 1, 1: 0, 2: 2, 3: 19, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!