ID: 1103478184_1103478189

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1103478184 1103478189
Species Human (GRCh38) Human (GRCh38)
Location 12:121233563-121233585 12:121233580-121233602
Sequence CCTGGGCTCTCCACAGCCCCATC CCCATCAAAGAACAGAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 49, 4: 503} {0: 1, 1: 0, 2: 1, 3: 32, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!