ID: 1103502633_1103502635

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103502633 1103502635
Species Human (GRCh38) Human (GRCh38)
Location 12:121415341-121415363 12:121415362-121415384
Sequence CCTGGCATAGTGGCTCACACTTG TGTAATCTGAGCACTTCAGGAGG
Strand - +
Off-target summary {0: 32, 1: 1196, 2: 16048, 3: 56759, 4: 125615} {0: 2, 1: 155, 2: 3376, 3: 38310, 4: 366536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!