ID: 1103515270_1103515275

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1103515270 1103515275
Species Human (GRCh38) Human (GRCh38)
Location 12:121503758-121503780 12:121503798-121503820
Sequence CCTTGTTCCTTAAAGTAATTCAG GTTATGCCCATATCATAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 246} {0: 1, 1: 0, 2: 0, 3: 1, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!