ID: 1103525143_1103525150

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1103525143 1103525150
Species Human (GRCh38) Human (GRCh38)
Location 12:121562620-121562642 12:121562646-121562668
Sequence CCAGTAAATCTGTAAGGGAAGAA ATGGAGGAGGAGGAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223} {0: 4, 1: 93, 2: 704, 3: 2356, 4: 7155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!