ID: 1103525788_1103525793

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103525788 1103525793
Species Human (GRCh38) Human (GRCh38)
Location 12:121567301-121567323 12:121567316-121567338
Sequence CCCCAGCACCTCAGAATGTAGCC ATGTAGCCATATTTGGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 75, 3: 392, 4: 1243} {0: 1, 1: 2, 2: 64, 3: 508, 4: 2070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!