|
Left Crispr |
Right Crispr |
Crispr ID |
1103550090 |
1103550099 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:121730525-121730547
|
12:121730565-121730587
|
Sequence |
CCTGTAGCCCCAACTACTTGGAA |
CACTTCAATCCAGGAGGCGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 113, 2: 3920, 3: 56831, 4: 177094} |
{0: 3, 1: 512, 2: 9337, 3: 41491, 4: 91416} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|