ID: 1103597807_1103597813

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103597807 1103597813
Species Human (GRCh38) Human (GRCh38)
Location 12:122034835-122034857 12:122034872-122034894
Sequence CCTTCCTAACTCCTCTTGCGCTT AGTGGAGTACACTTTGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174} {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!