ID: 1103612969_1103612982

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1103612969 1103612982
Species Human (GRCh38) Human (GRCh38)
Location 12:122135296-122135318 12:122135340-122135362
Sequence CCACCGTGTCCCAGTCCAACGTG GCCAGGGTGAGGAGGGCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} {0: 1, 1: 0, 2: 6, 3: 43, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!