ID: 1103614843_1103614849

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1103614843 1103614849
Species Human (GRCh38) Human (GRCh38)
Location 12:122145541-122145563 12:122145579-122145601
Sequence CCGGCAGCTGGGGTGCAGGTAAG GGGGAGCTGCAGCTGAGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 242} {0: 1, 1: 0, 2: 2, 3: 25, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!