ID: 1103703168_1103703179

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1103703168 1103703179
Species Human (GRCh38) Human (GRCh38)
Location 12:122858427-122858449 12:122858446-122858468
Sequence CCTTGGCAGGTGAGTGTAGCCAG CCAGGGCAGGGCGGAGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193} {0: 1, 1: 1, 2: 14, 3: 144, 4: 1182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!