ID: 1103730813_1103730825

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1103730813 1103730825
Species Human (GRCh38) Human (GRCh38)
Location 12:123026650-123026672 12:123026702-123026724
Sequence CCTTCCACCTTGGCCTTGCTGGG GCAGACTTCACGCCTTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 792} {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!