ID: 1103731361_1103731369

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1103731361 1103731369
Species Human (GRCh38) Human (GRCh38)
Location 12:123029917-123029939 12:123029959-123029981
Sequence CCAGAAACTGGGAAAACAGACCC TGAGACACTCACTGTCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 276} {0: 1, 1: 0, 2: 1, 3: 17, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!