ID: 1103733873_1103733879

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1103733873 1103733879
Species Human (GRCh38) Human (GRCh38)
Location 12:123046180-123046202 12:123046198-123046220
Sequence CCCAGTCCTGCCTTTCCTGAAGG GAAGGTATTCCCAGTGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 300} {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!