ID: 1103735162_1103735170

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1103735162 1103735170
Species Human (GRCh38) Human (GRCh38)
Location 12:123056546-123056568 12:123056568-123056590
Sequence CCAACTCCAGGAGGCCCAGACCC CAGGAGTGGCCTCCTGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 503} {0: 1, 1: 0, 2: 2, 3: 34, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!