ID: 1103779310_1103779318

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1103779310 1103779318
Species Human (GRCh38) Human (GRCh38)
Location 12:123388890-123388912 12:123388908-123388930
Sequence CCTGGCGGCGCCGCCCCTACCAG ACCAGCCCCCTCCCCGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157} {0: 1, 1: 1, 2: 3, 3: 64, 4: 651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!