ID: 1103779379_1103779398

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103779379 1103779398
Species Human (GRCh38) Human (GRCh38)
Location 12:123389062-123389084 12:123389108-123389130
Sequence CCGGCCATGGGGGAAGGGGGCGC CCGGGGCGCCGCGGCGGCGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 18, 4: 264} {0: 1, 1: 1, 2: 11, 3: 119, 4: 938}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!