ID: 1103779389_1103779398

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1103779389 1103779398
Species Human (GRCh38) Human (GRCh38)
Location 12:123389094-123389116 12:123389108-123389130
Sequence CCGCCGGCCCTTCCCCGGGGCGC CCGGGGCGCCGCGGCGGCGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 32, 4: 334} {0: 1, 1: 1, 2: 11, 3: 119, 4: 938}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!