ID: 1103844629_1103844632

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1103844629 1103844632
Species Human (GRCh38) Human (GRCh38)
Location 12:123892857-123892879 12:123892871-123892893
Sequence CCTCCCTTGCAACAAGCAGAAAT AGCAGAAATATCTCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175} {0: 1, 1: 0, 2: 7, 3: 72, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!