ID: 1103855340_1103855343

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1103855340 1103855343
Species Human (GRCh38) Human (GRCh38)
Location 12:123965026-123965048 12:123965042-123965064
Sequence CCCCACGGATGAGCTGCTGGGTC CTGGGTCTTTTTTTGAATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129} {0: 1, 1: 0, 2: 1, 3: 22, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!